|
Waldman's Biology Site |
||||||||
| Course Expectations
|
BioHW1112Posted by Howard Waldman, 1/4/12 at 2:55:02 PM.
BioHW1011 1. Read through Course Expectations. 2. Read chapter 1. 1.
Concept Check 1.1 2.
Concept Check 1.2 3. Take notes on 1.3 Sept. 9: 1. Define what makes a thing living 2. Google benzalkonium chloride, or thymol or ethyl alcohol or soap and water. Explain how it kills germs. Sept 12: Read Chapter 36.1 Concept Check 36.1 1. How are the movement of energy and the movement of chemicals in ecosystems different? 2. In the following food chain, identify the trophic levels: An owl eats a mouse that ate berries. Sept 13: Read 36.2 Concept Check 36.2 1. What does primary productivity measure? What does it tell you about an ecosystem? 3. What does the shape of the energy pyramid indicate? Sketch a food web based on the creatures we have found and what roles they play in ecosystems. Sept 14: no homework Sept 15: Construct a sketch of a food web based on the animals and plants we discussed. Remember, this is just a start˘a preliminary food web. Read 36.3 Concept Check 36.3 2. Explain how photosynthesis and respiration are involved in cycling carbon and oxygen. 4. Follow a raindrop through one possible path through the water cycle, ending as water vapor in the atmosphere. Sept. 16: Make your food web diagram from the ≥Fieldston Forest≈, with a minimum of 20 species. Read 36.4 Concept Check 36.4 1. Describe how increased quantities of carbon dioxide in the atmosphere may contribute to global warming. 2. Give an example showing how pollution relates to biological magnification. Sept. 19: Read 35.1, just the first two sections: Defining Populations Population Density Read 35.2 Concept Check 35.2 1. Describe how a population grows with unlimited food, space, and water. 2. Describe what happens when a population reaches its carrying capacity in a particular environment. Due Sept 27: Part I: Make up a test that a person needs to pass in order to become a "citizen of the ecosystem." It should have at least five questions, each of which should be answered by a few sentences OR a diagram. Part II: Write an "answer key" to this test. Part III: Get a friend or family member to take the test (He or she can remain anonymous.) Grade the test and hand that in as well with your corrections. Sept 21: Read 2.1-2.2. Look at Method. P35: 1-4 Concept Check: 1. Write
a hypothesis to explain why a door hinge squeaks. Then use your hypothesis to
make a prediction that could be tested.
Oct 3: Read Food Burn Lab, #1 and #2 for tomorrow. Be prepared to go over experiment set up.
Oct 6: 1. Describe your results so far of the burning lab. (a few sentences: what the numbers tell you, in your own words) 2. Make sure your group≠s data are in the GDocs spreadsheet for analysis: FoodBurn11 3. Calculate, for your group≠s data, the Kcal/g released by each food item: 1. Kilocal = 20 X (change in Temp) ÷ (1000) X 1, and then divide by change in grams.
For extra credit : Read and summarize main points of the forest article: http://www.nytimes.com/2011/10/01/science/earth/01forest.html?_r=1&scp=3&sq=forests&st=cse by Tuesday
Oct 7: Write drafts of the I, A parts of your IMRAD lab report. Do not drop them to me. Bring them in and we will go over them in class. 1. Write an introduction to your lab report. (I) 2. Begin the Analysis part of your lab report (A). Even though you haven≠t made any graphs yet, look at your group≠s data, and look at the class data (FoodBurn11), and describe in a few sentences any pattern that you see.
Oct 11: 1. Make your column graph of kcal/g for your group≠s data. It should like the class average graph, but the exact heights of the bars will be different. 2. Complete writing your Analysis section of the lab report.
Oct 12: Food Burning Lab Report due Monday. For tomorrow: Read 4.2-4.3
Oct 18: Read 5.1-5.3 Concept Check 5.1 Concept Check 5.2 Concept Check 5.3
Oct20: Read 5.4 √ 5.5 Concept Check 5.4
Oct 21: Read Enzyme Lab. Fill out sheet (for yourself), and prepare lab notebook.
Oct 27: Click on the word Enzyme for the link to the spreadsheet where you can enter data for the lab. Is there a pattern?
Oct 28: Make a line graph of the average time it takes a disk to rise in the HP beaker based on the temperature of the catalase enzyme. 1. For each temperature (6, 24, 33, 47, 86, 100) calculate the average time. 2. Put those average times on the Y-axis. The X-axis is those temperatures above. Quiz on Friday: 1. Understand the terms: a. Dehydration Synthesis b. Hydrolysis c. Enzyme d. Monomer and polymer e. homeostasis 2. Know these pairs and how they relate: a. Monosaccharides-Polysaccharides (Carbohydrates) b. Lipids-Fats & Steroids c. Amino Acids-Polypeptides (Proteins) 3. Understand what goes into the shape of a protein a. Know what will denature it b. Understand how an enzyme can speed up the rate of a chemical reaction
Nov 4: Read 7.1 (some of this is review) Concept Check 7.1 Read 8.1 Concept Check 8.1
Nov 7: Read 8.2. Concept
Check 8.2 November 9: Read Photosynthesis Lab and prepare lab notebook. If you want you can print the chart and paste it in your lab notebook, but you may do the chart by hand. Be sure to familiarize yourself with the lab procedure. Nov 11: 1. Please enter your group≠s data on the spreadsheet. Because there are a lot of data, perhaps you can split up the different wavelengths of light. Here is the link: https://docs.google.com/spreadsheet/ccc?key=0AtGU4iV25bujdFJpbXhlaWloWkFzSFoya0hjcmtDZUE&hl=en_US#gid=0 3. Make a scatter graph or a line graph of YOUR GROUP≠S DATA. This graph will look have five lines (no light, white light, green light, red light, blue light). The X axis will be TIME. Nov 14: Make sure your group data look right! https://docs.google.com/spreadsheet/ccc?key=0AtGU4iV25bujdFJpbXhlaWloWkFzSFoya0hjcmtDZUE&hl=en_US#gid=0 1. Do your group graph 2. Do Activity 8.2, especially the second page in your on-line textbook. 3. Try to answer the question: ≥Is there any reason I might expect the blue light treatment not to do well?≈ November 15: This link is to an EXCEL spreadsheet with the cleaned up data: Photo11clean. 1. Make a class average graph. 2. Write an analysis section: a. Describe any patterns you see on the class average graph. b. Compare to what you see on your group≠s graph. November 16: By now, you should have two graphs from the Photosynthesis lab: your group graph and your class graph. No need to send them to me. Do drop your analysis to me. Read 8.3 and answer: Concept
Check 8.3 November 18: Read 7.3 and 7.4 Concept Check 7.4 November 21: Read 7.5 There is a lot of information in this section. The first part is review from today≠s lesson, but then there is a lot that is new. Just read it over realizing that we are going to go over the details. Concept Check 7.5 November 28: Read 8.4 Concept Check 8.4 November 29: Read 6.5 Concept
Check 6.5
December 1: 1. Read over Metabolism Lab. Write short answers to the pre-lab questions 1-4. 2. The Photosynthesis-Respiration Poster project is due Tuesday Dec 6th. December 6: Please enter data for Metabolism lab in appropriate spaces: https://docs.google.com/a/ecfs.org/spreadsheet/ccc?key=0Au8w9PGjgEG_dHk0dlZyc0FabEVTbzBWMHdWS2VEU3c#gid=0 (If you haven≠t already, finish you poster project.) December 7: Metabolism Lab:
20 25 30 35 40 45 50 55 60 mouse room mouse fridge lizard room lizard fridge Then create a scatter graph (no need to connect the dots).
Dec 8: Study for short quiz on Photosynthesis and Respiration. Read the first ten pages of ≥Stats.≈ Until page 8 it is review of what you know. From page 8 to 10 read carefully, but you don≠t have to calculate anything. We will go over how to use EXCEL to calculate the Standard Deviation of a sample, in class. Jan 4:1. Drop your notes for your cell organelle, with one image, to me. Tomorrow you will have time in class to go over how you will present it with any other students that studied the same part. 2. Lab report due Monday. January 18: 1. Know the procedure for our lab activity. 2. Study for cell parts quiz on Wednesday Jan. 25 January 19: 1. Enter data 2. Check out organelles1112 for review information. January 20: Data are at Clean Potato You should have 2 graphs: 1. Your group graph ( a bar (column) graph of the % differences. 2. The class bar graph of the mean % differences. 3. A short paragraph analyzing the graphs. Also, keep studying for quiz on Wednesday Jan. 25 Jan 24: Keep studying for quiz on Wednesday Jan. 25 Osmosis Lab Report due Tuesday Jan. 31st: 1. Introduction: Explain osmosis. Explain how we can use osmosis to determine the average solute concentration of a potato. 2. Results: 2 graphs, 1 table of group data. Include sentences that orient us to the graphs, etc. 3. Analysis: As already written on Jan 20. Note the solution concentration which you think is the isotonic concentration. Discuss STDEV and T-test. 4. Discussion: Reiterate what you think the isotonic concentration is. Explain why you think that. Discuss errors and a future experiment. January 27 Read 11.1-11.2 in textbook. No written homework from this reading, just work on lab report, which is due Tuesday, January 31. January 31: Read 11.4-11.5 Concept Check 11.4 2. Which molecule completes the flow of information from DNA to protein? 3. Which amino acid is coded for by the RNA sequence CUA? 4. List two ways RNA is different from DNA. Feb 1: Read 11.3. Concept Check 11.3 1. Describe how DNA replicates by using a template. 2. List the steps involved in DNA replication. 3. Under what circumstances is DNA replicated? Feb 2: This website has all genetics material and simple animations. Very Good! http://learn.genetics.utah.edu/ Read 11. Concept Check 11.5 1. What kind of nucleic acid is made during transcription? 2. How do introns and exons relate to RNA splicing? 3. List the three RNA types involved in transcription and translation, and describe the role of each. Alzheimer's articles http://www.nytimes.com/2012/02/02/health/research/alzheimers-spreads-like-a-virus-in-the-brain-studies-find.html Feb 3: Read 11.6 Concept Check 11.6 1. Explain why a base substitution is often less harmful than a base deletion or insertion. 2. Describe how a mutation could be helpful rather than harmful. Feb 7: Read the following DNA sequences and provide: 1. the mRNA sequence 2. the tRNA sequence 3. the amino acid sequence 1. TACAAAGTTATACTACCCTCTATT 2. TACTTCGCTAATCGCTATCTCACT 3. TACCCCATCGCGCTATCTCGAACT Feb 10: Quiz on protein synthesis Thursday Feb. 16th. Youtubes to help you: 1. Write a description transcription in your own words. 2. Write a description of translation in your own words. Feb 13: Quiz 1. Transcription 2. Translation 3. Application: make an amino acid sequence from DNA I give you. (BE comfortable using the "Rosetta Stone" to find amino acids and t-RNA's) 4. Know DNA and RNA structure. 5. mutations: base substitution,addition, deletion (reading frame error) 6. helicase, ligase, RNA polymerase Feb 15: Read 9.2 Concept Check 9.2 1. Describe how the appearance of chromosomes changes as a cell is about to divide. 2. Interphase used to be described as a "resting phase." Why is this description inaccurate? Feb 16: Read 9.3 Concept Check 9.3 1. Describe a significant event that occurs in each of the four stages of mitosis. 2. Compare and contrast cytokinesis in animal and plant cells. Feb 18: Read 9.5 and 9.6 Concept Check 9.5 1. Describe how homologous chromosomes are different from sister chromatids. 2. Compare the number of sets of chromosomes in human gametes with the number of sets in other cells in the body. 4. What is the final result of meiosis? Concept Check 9.6 2. Describe how crossing over during meiosis in an individual organism recombines the genetic material of the organism's two parents. 3. Describe two differences between meiosis and mitosis. Feb 22: Review Meiosis notes and textbook.
February 23 Feb 23: No homework, but here is a very interesting article from the New York Times about the Y chromosome, that I will mention in class on Monday: http://www.nytimes.com/2012/02/23/science/y-chromosome-though-diminished-is-holding-its-ground.html?_r=1&emc=eta1 : Study for Mitosis/Meiosis Quiz on Thursday March 1. Mitosis Meiosis Quiz 1. IPMAT: every single stage and what they do. 2. The differences between mitosis and meiosis 3. Vocabulary: gametes, haploid, diploid, chromatin, sister chromatids ,homologous chromosomes, centromere 4. What is the point of mitosis? meiosis? Know how to describe/or draw/ or put piper cleaners into place to show ANY phase of mitosis or meiosis. Feb 27:
Read 10.1-10.2(up through the section "Genotype and "Phenotype") Concept Check 10.1 1. What are the two possible gametes produced by a plant that has the genotype Aa? Give the probability of each type of gamete. 2. Use a Punnett square to predict the genotypes produced if the plant in Question 1 is self-fertilized. Calculate the probability of each outcome. Leap Day:
Concept Check 10.2<o:p>< 3. List all the possible genotypes of a pea plant with purple flowers and round seeds.<o:p><
4. List the four possible allele combinations in the gametes of a plant with genotype PpWw.<o:p><
Concept Check 10.2 3. List all the possible genotypes of a pea plant with purple flowers and round seeds. 4. List the four possible allele combinations in the gametes of a plant with genotype PpWw.
Concept Check 10.3 1. For a trait with intermediate inheritance, what is the phenotypic ratio for F2 offspring of a monohybrid cross? How is that different from a simple dominant-recessive cross? 2. Two parents have type O blood. What blood type would you expect for their first child? 3. What is the likely mechanism of inheritance for a character with a large range of phenotypes? Explain.
March 2: Read 10.5
Concept Check 10.5 Enter your results on Google doc I share with you.
March 5: chi square values df 0.10 0.05 0.025 0.01 0.001 1 2.706 3.841 5.024 6.635 10.828 2 4.605 5.991 7.378 9.210 13.816 3 6.251 7.815 9.348 11.345 16.266 To Calculate your chi-square value: 1. Calculate the "expected frequency" for each class. (In this case, you have two classes, one should be 3/4 of the total counted and the other should be 1/4 of the total counted. 2. For each "observed frequency," subtract the "expected" from the "observed" and square the result. Then divide that number by the "expected" for that class. 3. Sum up the two results (one for each class) (Recall that class just refers to the possibilities, like purple and yellow or wrinkled and smooth.). That is your chi-square value. 4. Compare your chi-square to the 3.841 value (see above). If your value is LESS than 3.841, then p>.05. If your value is GREATER than 3.841, then your p<.05. TELL ME WHAT YOUR RESULT MEANS. March 6:
Concept Check 10.2
3.
List all the possible genotypes of a pea plant with purple flowers and round seeds.
4.
List the four possible allele combinations in the gametes of a plant with genotype PpWw
Read 10.4 but don't answer any questions
March 8: 1. Calculate the chi-square and the p-value for the dihybrid corn cross. Remember that there are 4 observed "classes" or categories. If you look at the table above you will see .05 value for three degrees of freedom: 7.815.2. Explain what your result means. March 9: 1. Write a short discussion section about how dihybrid corn results. Tell me your chi-square and p value, and talk also about the class results. Explain what these results mean, and any errors that might have occurred in the "experiment." 2. Answer the following problems from the genprobs documents: a. mixedprobs - Incomplete Dominance #1, Multiple Alleles #2 b. dihybrid - #1 March 12: Genetics Problems: 1. dihybrid #4 2. linkage #1 3. mixedprobs a. Test Cross #2 b. Incomplete Dominance #2 c. Sex-linked crosses #1 March 13: changed my mind: no homework! April 2: Read 14.1-14.2 Concept Check 14.1 1. How did the work of Lyell and Malthus influence Darwin as he developed his theory of evolution? 2. What characteristics of the Galápagos Islands were particularly important for Darwin? Concept Check 14.2 1. Why are older fossils generally in deeper rock layers than younger fossils? 3. What are homologous structures? April 4: Read 14.3 - 14.4 Concept Check 14.3 3. Describe what is meant by a "biologically fit" organism. 4. Describe the Grants' hypothesis about how environmental conditions led to microevolution among the finches of Daphne Major. 5. What are the two main forces of evolutionary change in gene pools? Read Beak Length12 Copy table into lab notebook or EXCEL spreadsheet.
April 10: Make two graphs of your group's data from today's simulation experiment. 1. Graph 1 is a line (or scatter) graph of the percentages of each beak length in the population for each generation. It should look like 4 lines, some going up, some going down, all starting at .25 (25%) for generation 0. 2. Graph 2 is a line (or scatter) graph of the average beak length of the population over the 6 generations. To get the average length in any generation, add up the lengths of all the birds you have in that generation, and divide by the total number of birds. Do this for each generation. We will analyze in class. April 11: Write an analysis of the trends from the two kinds of graphs (April 10), comparing your group's data to the class average. This can be in two short paragraphs. April 12: Write a proposal for your Science Expo project (one per group). Describe the experiment, what your hypothesis will be, how you will analyze the data(e.g., what statistics you might use), and (VERY IMPORTANT) what materials you will need. April 14: for the lab report: I want you to write: 1. Analysis of the four graphs 2. Discussion section: was your hypothesis supported? Can you explain what the graphs mean? What sources of error were there in this lab? Finally, are simulations a good method for understanding what is happening in nature? Why or why not? Use this lab as an example. April 19: Evolution Take Home due Thursday April 26 1. Write a short letter to a friend or relative explaining the evidence for evolution. 2. a. Describe the three necessary and sufficient conditions required for evolution by natural selection to occur. b. Describe an extra condition that makes natural selection a stronger force. 3. Describe how a new species forms. 5-14 For Tuesday, Wednesday: Read 28.1-28.3 Dr. Church teaches on the nervous system. For Wednesday: drop me a draft of your Science Expo stuff, so I can look at it. For Thursday, be ready to present on your body system. Friday: we place material on boards. Body System assignments: 1. Muscular: JE 2. Skeletal: BD 3. Circulatory: ZJ2 4. Respiratory: RA 5. Digestive: JA 6. Endocrine: JF 7. Excretory: SC 8. Reprodctive: NAC 9. Immune: SS Body System: Requirement: 1. 1-2 Pictures to post 2. Notes, to post 3. Oral Presentation 4. 2-3 concepts for the quiz
|
|||||||
|
Last update: Monday, May 14, 2012 at 10:16:53 AM. This site is using the Vanilla Manila 1999 theme. |
||||||||